Primer sequences used for the test describe in ISO18074 Textiles -- Identification of some animal fibres by DNA analysis method – Cashmere, Wool, Yak and their blends

The sequences of primer sets for the testing described in ISO18074 were written below. These were mentioned in the section 4.9 – 4.12, and 7.21 in the International standard. Annealing temperature of PCR (9.5.2) should be set for 62 ˚C for those primer sets.


4.10 primer for cashmere (DNA fragment of 239 bp should be amplified)
Forward: gtggtagctatttttatctgggctt
Reverse: gctttattttagcactagaaaccgc


4.11 primer for wool (DNA fragment of 385 bp should be amplified)
Forward: ggagtgcacccaggaaagattc
Reverse: ccaaccgaaactgttaactcataaggag


4.12 primer for yak (DNA fragment of 333 bp should amplified)
Forward: gataccgcggccgttaaacag
Reverse: actcctagccccaatactggactaa


7.21 primer amplification verification sample in the reaction solution (DNA fragment of 480 bp should be amplified)
Forward: gaagctgctgcctgatactgac
Reverse: gtcctttttgagttcattcgtaggctag



Contact person:
Hideaki Koike, PhD
Project Leader of ISO18074
Senior researcher, Bioproduction Research Institute,
National Institute of Advanced Industrial Science and Technology (AIST)
e-mail: hi-koike(at)aist.go.jp

Koji Kawabata
BOKEN Quality Evaluation Institute
e-mail: k-kawabata@boken.or.jp


(at) should be @.